Skip Main Navigation
NIH
MGC

MGC Home

Clone Info

Sequencing Info

MGC Info

Other Species Collections

Useful Links

pExpress-1 Vector Map

Below is a map of the pExpress-1 vector used in the construction of specific MGCC libraries by Express Genomics. A brief overview of the propietary method can be found at pExpress-1 library method overview.

pExpress1 Multiple Cloning Sites and Primer Binding Regions: 641-836

The sequence listed here is the (-) strand.

           700
 
  M13 pUC Forward 23-Base Sequencing PrimerT7 Promoter Primer
  5'-CC CAGTCACGAC GTTGTAAAAC G-3' 5'- TAATACGACT CACTATAGGG -3'
5'- GCAGTTTTCC CAGTCACGAC GTTGTAAAAC GACGGCCAGT GCCTAGCTTA TAATACGACT CACTATAGGG ACCACTCCTC
 <------------T7 Promoter------------>  

 
cDNA Insert
 <-----------SP6 Promoter------------>
 GAGGTTAATTAAGCGGCCGCCCATCCCGGGAATTCCGGAGCGAAACTTGTTCTATTAGTGTCACCTAAATA
 XhoI       PacI           NotI           SmaI    EcoI           RsrII 3'-GATATCACA GTGGATTTA-5'
   SP6 Promoter Primer

 800
 
 GGCCTAATGGTCATAGCTCTGTTTCCTGTGTGAAATTGTTATCCGCT-3'
 3'-GGACACACTTTAACAATAGGCGA-'5
 M13/pUC 23-Base Sequencing Primer