pMK-U

Molecule Definition:

 

pMK-U,  2300 bps DNA Circular

 

Description:    GeneArt vector

 

Molecule Features:

 

Type     Start     End   Name         Description

 

REGION     320     342   T7 Pro       T7 promoter

REGION     560    1227   Ori          Col E1 origin of replication

GENE      2172    1375 C KanR        

 

Vector Sequence

ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaac
caataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgct
acagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcg
ctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttccc
agtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattgaagg
aaggccgtcaaggcccctcagcagacatnnnactttcgctgaggggcctcatgggccttcctttcactgc
ccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggtcatagctgtttccttgcgtattg
ggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttcgggtaaagcctggggtgcctaat
gagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccg
cccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaaga
taccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacc
tgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggt
gtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatcc
ggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaaca
ggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacac
tagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctct
tgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaa
aaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacg
ttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagt
tttaaatcaatctaaagtatatatgagtaaacttggtctgacagttattagaaaaattcatccagcagac
gataaaacgcaatacgctggctatccggtgccgcaatgccatacagcaccagaaaacgatccgcccattc
gccgcccagttcttccgcaatatcacgggtggccagcgcaatatcctgataacgatccgccacgcccaga
cggccgcaatcaataaagccgctaaaacggccattttccaccataatgttcggcaggcacgcatcaccat
gggtcaccaccagatcttcgccatccggcatgctcgctttcagacgcgcaaacagctctgccggtgccag
gccctgatgttcttcatccagatcatcctgatccaccaggcccgcttccatacgggtacgcgcacgttca
atacgatgtttcgcctgatgatcaaacggacaggtcgccgggtccagggtatgcagacgacgcatggcat
ccgccataatgctcactttttctgccggcgccagatggctagacagcagatcctgacccggcacttcgcc
cagcagcagccaatcacggcccgcttcggtcaccacatccagcaccgccgcacacggaacaccggtggtg
gccagccagctcagacgcgccgcttcatcctgcagctcgttcagcgcaccgctcagatcggttttcacaa
acagcaccggacgaccctgcgcgctcagacgaaacaccgccgcatcagagcagccaatggtctgctgcgc
ccaatcatagccaaacagacgttccacccacgctgccgggctacccgcatgcaggccatcctgttcaatc
atactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttg
aatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac