pMK

Molecule Definition:

 

Molecule:       pMK ,  2393 bps DNA Circular

 

Description:    GeneArt vector

 

Molecule Features:

 

Type     Start     End   Name         Description

 

REGION     320     342   T7 Pro       T7 promoter

REGION     353     500   MCS          Multiple Cloning Site polylinker

REGION     653    1320   Ori          ColE1 origin of replication

GENE      2265    1468 C KanR        

 

Vector Sequence

ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaac
caataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgct
acagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcg
ctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttccc
agtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattgaagg
aaggccgtcaaggcctaggcgcgccatgagctctaaagcttcgctcgagctgcggccgcacggatcctcg
aattcccaagcttatctcgagtagcggccgcttggatcccagaattctaggtacctcttaattaactggc
ctcatgggccttcctttcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggt
catagctgtttccttgcgtattgggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttc
gggtaaagcctggggtgcctaatgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttg
ctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggc
gaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttcc
gaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctca
cgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttc
agcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcc
actggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaag
tggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacct
tcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttg
caagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgac
gctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctaga
tccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagtta
ttagaaaaattcatccagcagacgataaaacgcaatacgctggctatccggtgccgcaatgccatacagc
accagaaaacgatccgcccattcgccgcccagttcttccgcaatatcacgggtggccagcgcaatatcct
gataacgatccgccacgcccagacggccgcaatcaataaagccgctaaaacggccattttccaccataat
gttcggcaggcacgcatcaccatgggtcaccaccagatcttcgccatccggcatgctcgctttcagacgc
gcaaacagctctgccggtgccaggccctgatgttcttcatccagatcatcctgatccaccaggcccgctt
ccatacgggtacgcgcacgttcaatacgatgtttcgcctgatgatcaaacggacaggtcgccgggtccag
ggtatgcagacgacgcatggcatccgccataatgctcactttttctgccggcgccagatggctagacagc
agatcctgacccggcacttcgcccagcagcagccaatcacggcccgcttcggtcaccacatccagcaccg
ccgcacacggaacaccggtggtggccagccagctcagacgcgccgcttcatcctgcagctcgttcagcgc
accgctcagatcggttttcacaaacagcaccggacgaccctgcgcgctcagacgaaacaccgccgcatca
gagcagccaatggtctgctgcgcccaatcatagccaaacagacgttccacccacgctgccgggctacccg
catgcaggccatcctgttcaatcatactcttcctttttcaatattattgaagcatttatcagggttattg
tctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccc
cgaaaagtgccac