pENTR223.1-Sfi (4311 bps DNA Circular) #

Invitrogen Custom Gateway Entry Vector

 

This vector carries two genes, ccdB and CmR, in the region between the two Sfi I sites that will be replaced by cloned DNA segments. The ccdB gene (DNA gyrase inhibitor) provides strong negative selection against vector molecules retaining this region, whereas CmR (chloramphenicol resistance gene) provides positive selection for propagating the vector. Because ccdB is toxic to most standard strains of E. coli, it is important to propagate this vector in E. coli DB3.1 (gyrA) or in ccdBSurvival competent cells (ccdB-resistant; T1 & T5 phage resistant), both available from Invitrogen.

 

Sequencing primers (M13F and T7 Rev) that prime from outside of the attL sites are generally suitable for sequencing inserts larger than ~500 nt, but they may provide incomplete sequences for smaller inserts, due to L1-L2 hairpin formation (Esposito et al. Biotechniques 35:914, 2003). In contrast, the use of sequencing primers GW1 and GW2 should be suitable for sequencing of all sizes of inserts.

 


 

 

 

Molecule Features:

 

Type Start End Name Description

 

REGION 268 295 rrnBT2

REGION 427 470 rrnBT1

REGION 537 552 M13f

GENE 570 665 attL1

REGION 607 631 GW1

GENE 1021 716 C ccdB

GENE 2024 1366 C CmR

REGION 2253 2229 C GW2

GENE 2290 2195 C attL2

REGION 2327 2308 C T7 Pro

REGION 2348 2332 C M13r

GENE 2560 3570 SpnR CDS

GENE 3637 4310 pUC Ori

 

pENTR223.1-Sfi Vector Sequence:

 

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGA

TACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGA

GCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCA

CGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGC

TAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTA

GTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTC

ACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAA

CAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTG

GCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAA

AACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGAC

CTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAA

AGCAGAAGGGCCGTCAAGGCCCTGCAGACTGGCTGTGTATAAGGGAGCCTGACATTTATA

TTCCCCAGAACATCAGGTTAATGGCGTTTTTGATGTCATTTTCGCGGTGGCTGAGATCAG

CCACTTCTTCCCCGATAACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCC

AGCTTTCATCCCCGATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATCTGACAGCA

GACGTGCACTGGCCAGGGGGATCACCATCCGTCGCCCGGGCGTGTCAATAATATCACTCT

GTACATCCACAAACAGACGATAACGGCTCTCTCTTTTATAGGTGTAAACCTTAAACTGCA

TTTCACCAGCCCCTGTTCTCGTCAGCAAAAGAGCCGTTCATTTCAATAAACCGGGCGACC

TCAGCCATCCCTTCCTGATTTTCCGCTTTCCAGCGTTCGGCACGCAGACGACGGGCTTCA

TTCTGCATGGTTGTGCTTACCAGACCGGAGATATTGACATCATATATGCCTTGAGCAACT

GATAGCTGTCGCTGTCAACTGTCACTGTAATACGCTGCTTCATAGCATACCTCTTTTTGA

CATACTTCGGGTATACATATCAGTATATATTCTTATACCGCAAAAATCAGCGCGCAAATA

CGCATACTGTTATCTGGCTTTTAGTAAGCCGGATCCACGCGGCGTTTACGCCCCCCCTGC

CACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAA

ACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATAT

TTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAA

CTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTA

GGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAAC

TGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGG

AAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCC

ATACGGAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAA

AACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTC

TGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCAT

TGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCT

CCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGA

AAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGC

TTCCCGGTATCAACAGGGACAGGCCTCATGGGCCCAGCTTTCTTGTACAAAGTTGGCATT

ATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAA

ATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCT

GTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAA

AATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTA

CCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACA

TAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCC

AGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTAT

GACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCC

GTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCT

AAAACAAAGTTAAACATTATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCA

GAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTAC

GGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTG

ACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCG

GCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGAC

GACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGC

AATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTG

CTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTT

GATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAAC

TCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGG

TACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAG

CGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAA

GAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAA

GGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTT

AACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCT

TCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTA

CCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGC

TTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCAC

TTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCT

GCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGAT

AAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAA

GGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGG

GAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGA

CTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGC

AACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT //

 

 


Appendix B

 

The following shows how to design synthetic CDSs that are substrates for attB x attP recombination, using BP Clonase, to transfer the CDS into the pDONR223.1# vector to create an Entry clone in the pENTR223.1 vector.

 

The reaction mediated by BP Clonase is:

 

pDONR223.1 (SpnR) + attB1-CDS-attB2 pENTR223.1-CDS (SpnR) + attR(CmR+ccdB) byproduct. (Here attB1-CDS-attB2 is a synthetic DNA.)

 

The products are transformed into standard E. coli competent cells, like DH5α or DH10B, and grown on spectinomycin-containing plates. Only the desired SpnR containing product should be obtained. A custom pDONR223.1 vector is available from Invitrogen for the purpose of this pilot study. #

 

attB1-CDS-attB2 has the following structure:

The recombinational transfer reaction with this attB1-CDS-attB2 is analogous to BxP cloning of attB-PCR products. Additional details on the cloning of attB-PCR products and the BP Clonase reaction conditions are available on the Invitrogen web site at: https://catalog.invitrogen.com/index.cfm?fuseaction=viewCatalog.viewProductDetails&productDescription=561&

 

# Invitrogen has granted to MGC and other entities involved in this DNA synthesis contract the right to use the pENTR223.1-Sfi and pDONR223.1 vectors, but solely for the purposes of this contract. Invitrogen also has agreed to the royalty-free distribution of Entry Clones produced from this contract for-profit and not-for- profit distributors of the MGC Program.

 


pDONR223.1 Map and Sequence

 

 

 

 

Molecule Features:

 

Type Start End Name

 

REGION 864 891 rrnB T2

REGION 1023 1066 rrnB T1

MARKER 1133 M13f

GENE 1166 1364 attP1

REGION 1203 1227 GW1

GENE 2098 1793 C ccdB

GENE 3101 2418 C CmR

MARKER 3543 C GW2

GENE 3580 3382 C attP2

REGION 3598 3617 T7Promoter

REGION 3638 3622 C M13r

GENE 3850 4860 SpnR

GENE 4927 593 Ori

 

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACT

GGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCAC

CACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTG

GCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCG

GATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGA

ACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCC

GAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACG

AGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTC

TGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCC

AGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTT

CCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACC

GCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGC

CCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGAC

AGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGC

CAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTT

GATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAA

CGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAAC

AGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAG

TTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACG

ACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGT

TCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCT

GAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAA

CAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGAT

GGTATTAGTGACCTGTAGTCGACCGACAGCCTTCCAAATGTTCTTCGGGTGATGCTGCCA

ACTTAGTCGACCGACAGCCTTCCAAATGTTCTTCTCAAACGGAATCGTCGTATCCAGCCT

ACTCGCTATTGTCCTCAATGCCGTATTAAATCATAAAAAGAAATAAGAAAAAGAGGTGCG

AGCCTCTTTTTTGTGTGACAAAATAAAAACATCTACCTATTCATATACGCTAGTGTCATA

GTCCTGAAAATCATCTGCATCAAGAACAATTTCACAACTCTTATACTTTTCTCTTACAAG

TCGTTCGGCTTCATCTGGATTTTCAGCCTCTATACTTACTAAACGTGATAAAGTTTCTGT

AATTTCTACTGTATCGACCTGCAGACTGGCTGTGTATAAGGGAGCCTGACATTTATATTC

CCCAGAACATCAGGTTAATGGCGTTTTTGATGTCATTTTCGCGGTGGCTGAGATCAGCCA

CTTCTTCCCCGATAACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAGC

TTTCATCCCCGATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATCTGACAGCAGAC

GTGCACTGGCCAGGGGGATCACCATCCGTCGCCCGGGCGTGTCAATAATATCACTCTGTA

CATCCACAAACAGACGATAACGGCTCTCTCTTTTATAGGTGTAAACCTTAAACTGCATTT

CACCAGCCCCTGTTCTCGTCAGCAAAAGAGCCGTTCATTTCAATAAACCGGGCGACCTCA

GCCATCCCTTCCTGATTTTCCGCTTTCCAGCGTTCGGCACGCAGACGACGGGCTTCATTC

TGCATGGTTGTGCTTACCAGACCGGAGATATTGACATCATATATGCCTTGAGCAACTGAT

AGCTGTCGCTGTCAACTGTCACTGTAATACGCTGCTTCATAGCATACCTCTTTTTGACAT

ACTTCGGGTATACATATCAGTATATATTCTTATACCGCAAAAATCAGCGCGCAAATACGC

ATACTGTTATCTGGCTTTTAGTAAGCCGGATCCACGCGGCGTTTACGCCCCCCCTGCCAC

TCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACG

GCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTG

CCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTG

GTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGG

AAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGC

CGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAA

ACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATA

CGGAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAAC

TTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGG

TTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGG

GATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCT

GAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAG

TTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTC

CCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGT

ATTTATTCGGCGCAAAGTGCGTCGGGTGATGCTGCCAACTTAGTCGACTACAGGTCACTA

ATACCATCTAAGTAGTTGATTCATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTA

GTCTGTTTTTTATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCT

CGTTCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGC

AACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCC

TATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAA

AATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGC

CAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGG

AAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGC

AAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAAC

GGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCT

CGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGC

AACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATTATGAGGGAAGCG

GTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTC

GAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCA

CACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGA

GCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGC

GCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAG

CGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCA

GCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCC

TTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAG

GCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGA

AATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCG

AAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATA

CTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGAT

CAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAA

CCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCG

TCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATC

TGCTGCTTGCAAACAAAAAAACCACCG //